Mongolian Medicine echinops prevented postmenopausal
osteoporosis and induced ER/AKT/ERK pathway in BMSCs
Yan Liu
1,2,
§
, Xiongyao Wang
3,
§
, Hong Chang
2
, Xiaoming Gao
2
, Chongyang Dong
3
, Zimu Li
3
Jingtao Hao
3
, Jiuhe Wang
4
, Qiaoling Fan
1,
*
1
School of Basic Medical Science, Nanjing University of Chinese Medicine, Nanjing, China;
2
Department of Traditional Chinese Medicine, Affiliated Hospital of Inner Mongolia Medical University, Hohhot, China;
3
College of Traditional Chinese Medicine, Inner Mongolia Medical University, Hohhot, China;
4
Department of Cardiology, Inner Mongolia Autonomous Rengion Hospital of Traditional Chinese Medicine, Hohhot, China.
1. Introduction
Osteoporosis (OP) is a metabolic bone disease
characterized by low bone mass and the destruction of
the microstructure of bone tissue, leading to increased
bone fragility and easy to fracture (
1,2
). OP is the sixth
most common chronic diseases in humans (
3
). It was
divided into two types: primary OP and secondary OP
(
4,5
). Primary OP can be divided into two subtypes,
namely Type I and Type II. Type I is postmenopausal
osteoporosis (PMOP), which occurs in postmenopausal
women (
6,7
). Type II is senile osteoporosis, most
200 million people worldwide suffer from osteoporosis,
of which postmenopausal women account for 1/3 (
8,9
).
The overall incidence of OP in Chinese population
over 60 is 22.6%, with 15% for males and 28.6% for
females, with a trend of increasing year by year (
10
). The
incidence of OP in the United States is also quite high,
about 20,000 cases of OP fractures, and 65,000 cases
Summary
effective in decreasing the risk of osteoporosis. Mongolian medicine echinops prevents
osteoporosis, but its mechanism remains unclear. In this study, we explored the mechanism
underlying echinops prevents and treats postmenopausal osteoporosis. Osteoporosis model
was established by ovariectomy in rats. Rats were treated to Echinops (16.26, 32.5, or 65 mg/
kg/day) by oral gavage for 3 months. Bone mineral density (BMD) was detected by micro-
CT detection of left proximal medial metaphyseal tibia. Hematoxylin and eosin (H&E) and
toluidine blue O staining were also performed. Serum levels of E2, ALP and testosterone
treated with echinops-containing serum. Estrogen receptors (ER) including ERα and ERβ in
bone specimens and BMSCs were detected by qRT-PCR. Cell viability and colon formation
of BMSCs were detected. Expressions of ERα, ERβ, AKT, p-AKT, ERK, and p-ERK in
BMSCs were detected by western blot. Results showed that echinops significantly increased
trabecular interconnectivity, thickness of trabeculae, and connection of trabecula. Echinops
significantly increased BMD and E2, but significantly reduced ALP and testosterone in dose-
Echinops enhanced cell viability and ability of colony formation of BMSCs, and increased
ERα, ERβ, p-AKT, and p-ERK. Thus, Mongolian echinops reduced bone loss and delayed the
occurrence and development of osteoporosis, and increased ERα, ERβ, p-AKT, and P-ERK
in BMSCs. These results provide experimental basis for clinical prevention and treatment of
postmenopausal osteoporosis by echniops.
Keywords:
Osteoporosis, echinops, ERα, ERβ, AKT/ERK pathway
DOI: 10.5582/bst.2018.01046
www.biosciencetrends.com
BioScience Trends
Advance Publication
2018.
§
These authors contributed equally to this work.
*
Address correspondence to:
Dr. Qiaoling Fan, School of Basic Medical Science, Nanjing
University of Chinese Medicine, 138 Xianlin Road, Qixia
District, Nanjing, Jiangsu 210023, China.
E-mail: njfanql@163.com; QLFan1803@yeah.net
Original Article
Advance Publication
died due to OP each year (
11
).
PMOP occurs in 5 to 10 years after menopause in
women, most of whom have an increased bone turnover
rate, due to fluctuations or gradually reduced in the
level of estrogen. In post-menopausal 5-7 years, women
lose about 20% of the bone mass (
12
). Although most
osteoporosis does not directly cause death, its greatest
risk is fractures, with high morbidity and disability
(
6,11
). Estrogen deficiency caused by postmenopausal
ovarian hypofunction is recognized as an important
cause of postmenopausal osteoporosis (
13-15
). Estrogen
replacement therapy is the preferred method of
treatment for PMOP, which can enhance bone mineral
density (BMD) and systemic bone mineral content, and
effectively treat postmenopausal osteoporosis (
16-18
).
However, the long-term use of estrogen increases the
risk of breast cancer, endometrial cancer, cardiovascular
accident and vascular embolism (
19
). In recent years,
the prevention and treatment of PMOP by traditional
Chinese medicine is attracting more and more attention
(
20,21
). It is of great significance to find an estrogen
replacement medicine for the prevention and treatment
of postmenopausal osteoporosis in traditional medicine.
Mongolian medicine echinops was introduced in the
canon of Mongolian Medical "Wisdom Ancientmirror".
It functions as strengthening bone, reuniting bone,
and callus (
22
). In recent year, it was showed that
echinops decreased the serum level of bone Glp protein
and inhibited osteoporosis in ovariectomized (OVX)
rats (
23
). Post-surgery 90 days, the OVX rats were
filled the stomach with echinops for 90 days and then
the serum level of alkaline phosphatase (ALP) were
significantly increased and serum level of interleukin-1
was significantly reduced (
24
). After successes of the
osteoporosis, OVX rats were feed 90 days and then filled
the stomach with echinops for 90 days, then BMD and the
maximum deflection of bone were increased compared
with OVX rats (
25
). These results implied that Mongolian
echinops can inhibit the bone absorption and promote the
bone formation, decreasing bone turnover, reducing bone
loss, delaying the occurrence and development of PMOP.
However, the mechanism underlying echinops prevents
and treats PMOP is still unclear.
In this study, we aimed to explore the roles of
estrogen receptors (ER; ERα and ERβ), p-AKT, and
p-ERK in BMSCs during echinops prevents and treats
postmenopausal osteoporosis.
2. Materials and Methods
2.1.
Animals and treatments
A total of 84 SPF healthy female Wistar rats (250 ± 20
g, 4 months) were purchased from the animal research
center of Inner Mongolia University, China (certification
number: SCXK (Mongolia) 2012-0001). The rats
received ad libitum access to standard chow pellets
and water in 24°C, 50-60% humidity. This study was
approved by animal ethics committee of Inner Mongolia
University. After 7 days in new environment, the rats
were anesthetized by intraperitoneal injection of 40 mg/
kg pentobarbital sodium (P3761, SIGMA-ALDRICH,
USA), shaved off the hair on the bilateral dorsal regions
for OVX surgery (
26
). The ovaries were exposed by a 2
mm incision and resected with surgical scissors. Then,
other exposed tissues were repositioned and incision
was sutured with 3.0 silk threads in a routine fashion.
Intraperitoneal injection of penicillin was administrated.
Rats in sham groups was incision without ligation of
ovaries artery.
Post-surgery 3 months (
26
), animals were treated to
echinops (16.26, 32.5, or 65 mg/kg/day) by oral gavage
for 3 months as previously reported (
25
). Echinops
was prepared as below: weigh 500 g of dried echinops
at 75°C, mixed with 10-time water, decocted for 1 h
and filtrated; the slag was decocted with same volume
water and filtrated again; the two filtration solutions
were collected and concentrated to 500 ml to obtain
1g/mL echinops stock solution. The rats in OVX and
sham groups received PBS daily. E2 treatment (E2758,
SIGMA-ALDRICH) was set as positive control. After
3 months, the rats were euthanized by intraperitoneal
injection of 40 mg/kg pentobarbital sodium, whole blood
was collected from the heart through cardiac puncture,
and the femur medial malleolus specimens were selected
at 1 mm under the epiphyseal plate. After centrifuged
at 3,000 rpm for 10 min, serum samples were collected,
filtered with 0.22 μm filter, and stored at -20°C for
subsequent experiments.
2.2.
Hematoxylin and eosin (H&E) and toluidine blue O
staining
The femur bones were fixed in 10% neutral buffered
formalin solution for 48 h, dehydrated in graded ethanol
(70-100%, cleared in xylene, embedded in paraffin, and
sectioned into 5 μm. For H&E staining, sections were
stained with hematoxylin for 3-8 min and eosin for 1-3
min. For toluidine blue O staining, sections were rinsed
in toluidine blue O solution for 1 min. The images were
observed by Olympus BX51 light microscopy (Olympus,
Japan).
2.3.
Micro-computed tomography (micro-CT) detection
Micro-CT of left proximal medial metaphyseal tibia
were acquired using Scanco Μct35 scanner (Scanco,
Switzerland) at 70 KVp, 114 μA for 800 ms. Bone
mineral density was evaluated based on the micro-CT
results.
2.4.
Serum levels of E2, ALP, and testosterone
After centrifuged at 3,000 rpm for 10 min, serum samples
P2
P3
were seeded in 6-well plates at 8
×
10
4
cells/well with
echinops-containing serum for 13 days. Then, cells were
fixed with 4% paraformaldehyde and stained with 0.1%
crystal violet.
2.8.
Western blotting
Protein was extracted using RIPA (Beyotime, China)
with PMSF (1:100) at 4℃ for 30 min, and quantified
by BCA assay (#23227, Thermo, USA). 30 µg protein
was separated by 8%SDS-PAGE and transferred to
PVDF membranes (IPVH00010, Millipore, USA).
The membrane was incubated with 5% non-fat milk
for 30 min, and incubated with primary antibodies
ERα (1:2,000), ERβ (1:4,000), AKT (1:1,500), p-AKT
(1:1,000), ERK (1:1,000), p-ERK (1:2,000), and
GAPDH (1:10,000) antibody at room temperature for
1 h, and then incubated with HRP goat anti-rabbit IgG
secondary antibody (1:20,000, BOSTER, China) at
room temperature for 40 min. The blots were detected
using Immobilon Western CHEMILUM HRP Substrate
(WBKLS0500, Millipore, USA), and light-producing
reactions are captured with X-ray film.
2.9.
Statistical analysis
Data were expressed as mean ± standard deviation, and
compared using one-way analysis of variance (ANOVA)
followed by Tukey's multiple comparison test. Statistical
analyses were performed using the SPSS 10.0 software
(SPSS, USA). Significance was considered at
p
3.
Results
3.1.
Echinops increased BMD and E2, but reduced ALP
and testosterone in dose-dependent manners
BMD at 90 days post-treatment was analyzed by
micro-CT (Figure 1A). Compared with sham group, a
significant reduction in BMD of cortical bone in OVX
group was observed (
p
)
not significantly increased the trabecular BMD, whereas
32.5 mg/kg (
p
)(
p
)
significantly increased the BMD of trabecular bone in
comparison to the untreated OVX rats.
The rats in OVX group showed lower level of E2
(
p
)ALP (
p
0.01, Figure 1C) and testosterone (
p
1D) than sham group. 16.26 mg/kg echinops not
significantly changed the levels of E2 and testosterone,
but significantly inhibited ALP level (
p
)
comparison to the OVX group. 32.5 mg/kg and 65 mg/kg
echinops significantly increased E2 level but decreased
levels of ALP and testosterone in OVX rats (Figure 1B-
D). There was not significant difference in ALP level
between 32.5 mg/kg and 65 mg/kg treatment groups
(Figure 1C).
were collected and stored at -20°C until enzyme-linked
immunosorbent assay (ELISA) detection. The levels of
E2 (CSB-E05108h, CUSABIO), ALP (A059-2, Nanjing
Jiancheng Bioengineering Institute), and testosterone
(05099h, CUSABIO) were determined by commercially
ELISA kits according to manufacturer's instruction using
an Multiskan microplate reader (Thermo, USA).
2.5.
qRT-PCR detection
Total RNA from bone specimens were extracted using
Trizol (Takara, Japan). The RNA quality and quantity
were examined using Nanodrop 1000 spectrophotometer
(NanoDrop, USA). RT reaction was performed
using Bestar qPCR RT kit (ABI, USA) according to
manufacturer's instruction on ABI9700 PCR system
(ABI, USA). The PCR reaction was performed using
DBI Bestar
®
SybrGreen qPCRmasterMix (ABI,
USA) on Stratagene Mx3000P Real time PCR system
(Agilent, USA) according to manufacturer's instruction.
The primer was listed below (5'-3'): R-GADPH
Forward CCTCGTCTCATAGACAAGATGGT,
reversed GGGTAGAGTCATACTGGAACATG;
ERα Forward AAGAAGAATAGCCCCGCCC,
reversed GCCAGGTTGGTCAATAAGCC; ERβ
Forward ATGCCCTGGTCTGGGTGAT, reversed
CCCCGAGATTGAGGACTTGT. Glyceraldehyde
3-phosphate dehydrogenase (GAPDH) was used as
internal control. Relative expression was calculated using
2
method and normalized to sham group.
2.6.
Bone marrow-derived bone marrow stem cell
(BMSC) isolation and flow cytometry identification
The rat femur was rinsed in PBS containing 1%
penicillin-streptomycin. After removal of both ends in
joints, the bone was rinsed in DMEM with low glucose
by a syringe until the bone pale. The mediums were
collected and centrifuged at 800 rpm for 5 min. Cells
were resuspended into DMEM with low glucose and
cultured in incubator at 37°C, 5%CO
2
. After 48 h, cells
were stained with primary antibodies of CD29 (ab179471,
Abcam, USA), CD90 (ab216449, Abcam), CD45
(ab10558, Abcam), CD11b (ab128797, Abcam), and
FITC-conjugated secondary antibody (ab6717, Abcam)
in the darker for 30 min. The CD29, CD90, CD45,
CD11b positive cells were analyzed using Epics-XL II
flow cytometry (Beckman Coulter, USA).
2.7.
Cell viability and colon formation
Cell viability was detected with a cell counting-8 kit
(CCK-8, Beyotime, China). Cells (5x105 cells) were
seeded in 96-well plates and incubated with echinops-
containing serum for 24, 48 and 72h. Then, CCK-8
was added and the absorbance was detected at 450 nm
on microplate reader. For colon formation assay, cells
P4
Thus, echinops increased BMD and level of
E2, but decreased levels of ALP and testosterone in
concentration- dependent manners.
3.2.
Echinops induced expression of ERα and ERβ
To detect the role of echinops on ERα and ERβ
expression, qRT-PCR assays were performed (Figure 2).
Compared with sham group, a significant decrease in
ERα and ERβ mRNA expressions were shown in OVX
rats (Figure 2A and B). Echinops administrated at 16.26,
32.5 and 65 mg/kg significantly increased ERα and ERβ
expressions in comparison to OVX group, showing a
dose-dependent manner (Figure 2A and B).
3.3.
Echinops inhibited osteopenia induced by OVX
After surgery for 90 days (
26
), rats in sham and OVX
group were treated with echinops (32.5 mg/kg) or E2
for 90 days. Then, rats were euthanized and bones were
collected. HE and toluidine blue O stainings showed a
typical osteopenia with widened intertrabecular spaces,
loss of trabecular bone thickness and interconnectivity
in OVX group, compared with sham group (Figure
3). Echinops or E2 treatment significantly increased
trabecular interconnectivity, thickness of trabeculae, and
connection of trabecula, compared with OVX group,
suggesting echinops inhibited the osteopenia induced by
OVX (Figure 3).
3.4.
Isolation and identification of BMSCs
To explore the mechanism in echinops treated
osteoporosis, BMSCs were isolated and identified by
flow cytometry of CD29, CD90, CD45, and CD11b.
There were 90.6% isolated-cells positively expressed
CD29 (Figure 4A), 93.8% positively expressed CD90
(Figure 4B), but only 4.5% positively expressed CD45
(Figure 4C), only 1.3% positively expressed CD11b
(Figure 4D). These results suggested the isolated cells
were almost BMSCs.
3.5.
Echinops enhanced cell viability and ability of
colony formation of BMSCs
To evaluate role of echinops in cell proliferation of
BMSCs, cell viability (Figure 5A) and colony formation
(Figure 5B and C) were performed. Echinops-containing
serum (65 mg/kg) significantly increased cell viability
(Figure 5A). Moreover, echinops-containing serum
significantly increased colony formation of BMSCs in
a dose-dependent manner (
p
mg/kg, and
p
)These
Figure 3. Echinops inhibited osteopenia induced by OVX.
After surgery for 90 days, rats were treated with echinops (32.5 mg/
kg) or E2 for 90 days. HE and toluidine blue O staining were performed. 200X; arrow heads: loss of interconnectivity; arrow:
trabecular bones.
Figure 1. Micro-CT detection of bone mineral density
(BMD) and Elisa detection of E2, ALP, testosterone levels.
After surgery for 90 days and treatment for 90 days,
(A)
micro-
CT was performed. Serum E2
(B)
, ALP
(C)
, and testosterone
(D)
levels were detected by ELISA. Low: 16.26 mg/kg; middle:
32.5 mg/kg; high: 65 mg/kg.
*
p
**
p
***
p
n.s: not significant by ANOVA test.
Figure 2. Effects of echinops on ERα and ERβ expression.
After surgery for 90 days and treatment for 90 days, qRT-
PCR detection of ERα mRNA
(A)
and ERβ mRNA
(B)
. Low:
16.26 mg/kg; middle: 32.5 mg/kg; high: 65 mg/kg.
*
p
**
p
***
p
ANOVA test.
P5
results suggested echinops-containing serum induced cell
proliferation of BMSCs in a dose-dependent manner.
3.6.
Echinops increased ERα, ERβ, p-AKT, and P-ERK
in BMSCs
To explore the mechanism in echinops treated
osteoporosis, expressions of ERα, ERβ, AKT, p-AKT,
ERK, and p-ERK in BMSCs after echinops-containing
serum treatment were examined (Figure 6). After
treatment of Echniops-containing serum, ERα and
ERβ levels were significantly increased compared
with control BMSCs (Figure 6A and B). Moreover, the
phosphorylations of AKT and ERK were significantly
induced in a dose-dependent manner (Figure 6C and D).
4.
Discussion
In this study, it was demonstrated that echinops functions
like estrogen. It can effectively prevent and treat PMOP.
Administrating echinops to ovariectomy-induced
PMOP model, the BMD and serum level of E2 were
increased, serum levels of ALP and testosterone were
decreased. Echinops induced expression of ERα and
ERβ in OVX rats. The mechanism in echinops prevented
PMOP was explored by treating isolated BMSCs
with echinops-containing serum. Echinops-containing
serum significantly increased cell viability and colony
formation of BMSCs, and increased ERα, ERβ, p-AKT,
Rats are the most used model animal in the studies
of osteoporosis so far (
14,27
). After ovariectomy in
female rats, bone turnover accelerated, bone loss and
bone strength decreased, which was similar to that of
people after menopause (
28
). Using OVX model, it is
Figure 4. Identification of BMSCs isolated from rats.
Flow
cytometry detection of
(A)
CD29,
(B)
CD90,
(C)
CD45 and
(D)
CD11b on isolated cells were performed.
Figure 5. Effects of echinops-containing serum on cell
viability and colony formation.
BMSCs were treated with
Echniops-containing serum that collected from rats administrated
with 16.26 (low), 32.5 (middle), and 65 (high) mg/kg echinops.
(A)
Cell viability.
(B, C)
Colony formation.
*
p
**
p
***
p
vs
. control.
Figure 6. Effects of echinops-containing serum on
expressions of ERα, ERβ, AKT, p-AKT, ERK, and P-ERK
in BMSCs.
BMSCs were treated with Echniops-containing
serum that collected from rats administrated with 16.26 (low),
32.5 (middle), and 65 (high) mg/kg echinops.
(A)
ERα mRNA.
(B)
ERβ mRNA.
(C)
ERα, ERβ, AKT, p-AKT, ERK, and
p-ERK.
(D)
Quantification of western bolts.
*
p
0.05,
**
p
0.01
vs
. control.
P6
easy to observe the effect of aging on bone tissue, the
distribution and reconstruction of cancellous bone in
rats and trabecular bone reconstruction of lamellar bone
that similar to human (
28
). In the present study, a PMOP
animal model was established in ovariectomized rats.
The ovaries were artificially removed and the estrogen
deficiency was induced in rats. The ERα and ERβ levels
were also decreased. After 3 months, osteoporosis model
was successfully replicated in OVX rats as previously
described (
26
).
Estrogen is recognized drug in the prevention and
treatment of PMOP, and diethylstilbestrol (E2) is a
synthetic non-steroidal estrogen which can produce
pharmacological and therapeutic effect similar to natural
estradiol, and significantly reduce the ovariectomy-
induced high bone turnover and -reduced bone resorption
(
29,30
). Therefore, this study selected E2 as a positive
control drug to validate the mechanism of Mongolian
medicine echinops in PMOP treatment. Similar effects to
E2 was demonstrated in this study.
After menopause, women's estrogen levels decreased
significantly, estrogen through the estrogen receptor (ER)
directly effect on the osteoblast and osteoclasts, lead
to imbalance of bone resorption and bone formation,
resulting in reduced bone mass and BMD, increased
bone fragility and the occurrence of osteoporosis (
31,32
).
The decrease of estrogen level and the decrease of the
expression of ER in bone tissue are one of the most
important pathogenesis. Estrogen can directly stimulate
osteoblasts formation, inhibit osteoclasts activity, and
regulate and control the balance of bone formation and
bone resorption through ER. ER is expressed in both
osteoblasts and osteoclasts (
33,34
). Osteoclasts is a very
active metabolic giant multinucleated cells, recruited
in the bone surface, and played important role in bone
resorption and formation of lacuna through release of
enzyme and acidic substances such as ALP to dissolve
the bone matrix (
34,35
). Osteoblasts can synthesize
the basic bone material, induces the formation of bone
(
33
). The combination of estrogen and ER in osteoclasts
induces the apoptosis of osteoclasts and osteoclasts
precursors, reduces the number of osteoclasts. On the
other hand, the combination of estrogen and ER in
osteoclasts inhibited the recruitment and differentiation
of osteoclasts precursors. In addition, estrogen regulated
by osteoprotegerin/osteoprotegerin ligand (OPG/OPGL)
system (
36
). The decline in estrogen levels results in a
dysregulated ratio of osteoprotegerin/osteoprotegerin
ligands leading to PMOP (
37
).
It was demonstrated that echinops decreased the
serum level of bone Glp protein, interleukin-1, but
increased serum level of ALP, increasing BMD, and
inhibiting osteoporosis in ovariectomized (OVX) rats
(
23-25
). Activation of ERK/PI3K plays important role in
ER-mediated cell proliferation (
38
). Daidzein stimulated
osteogenesis was mediated by both ERα and ERβ, and
activation of ERK/PI3K pathway (
39
). Consistently, the
findings in this study showed echinops reduced ALP and
testosterone serum levels in OVX rats, increased BMD
and inhibited osteoporosis. In isolated BMSCs, echinops
induced cell proliferation, increased ERα, ERβ, p-AKT,
and P-ERK. This might associate with the enhancement
of osteoblasts differentiation from BMSCs, inhibiting
bone absorption and promote bone formation.
In conclusion, Mongolian echinops reduced bone loss
and delayed the occurrence and development of PMOP,
and increased ERα, ERβ, p-AKT, and p-ERK in BMSCs.
These results provide experimental basis for clinical
prevention and treatment of PMOP by echniops.
Acknowledgements
This work was supported by National Natural Science
Foundation of China (No. 81573874), Inner Mongolia
natural science foundation (No. 2010MS1151, No.
2009MS1134 and No. 2014MS0839).
References
1.Zeng Y, Wu J, He X, Li L, Liu X, Liu X. Mechanical
microenvironment regulation of age-related diseases
involving degeneration of human skeletal and cardiovascular
systems. Prog Biophys Mol Biol. 2017; pii: S0079-
6107(17)30175-X. doi: 10.1016/j.pbiomolbio.2017.09.022
2.Aggarwal L, Masuda C. Osteoporosis: A quick update. J
Fam Pract. 2018; 67:59-65.
3.Sobieszczańska M, Jonkisz J, Tabin M, Laszkiszcząchor K.
Osteoporosis: genetic determinants and relationship with
cardiovascular disease. Adv Clin Exp Med. 2013; 22:119-
124.
4.Chang Y, Huang C, Hwang J, Kuo J, Lin K, Huang H,
Bagga S, Kumar A, Chen F, Wu C. Fracture liaison
services for osteoporosis in the Asia-Pacific region:
current unmet needs and systematic literature review.
Osteoporos Int. 2018; 29:779-792.
5.Lems WF, Raterman HG. Critical issues and current
challenges in osteoporosis and fracture prevention. An
overview of unmet needs. Ther Adv Musculoskelet Dis.
2017; 9:299-316.
6.McMillan LB, Zengin A, Ebeling PR, Scott D. Prescribing
Physical Activity for the Prevention and Treatment of
Osteoporosis in Older Adults. Healthcare (Basel). 2017; 5.
pii: E85.
7.Peng L, Luo Q, Lu H. Efficacy and safety of bazedoxifene
in postmenopausal women with osteoporosis: A systematic
review and meta-analysis. Medicine (Baltimore). 2017;
96:e8659.
8.Lello S, Sorge R, Surico N. Osteoporosis's Menopausal
Epidemiological Risk Observation (O.M.E.R.O.) study.
Gynecol Endocrinol. 2015; 31:992-998.
9.Lo SS. Bone health status of postmenopausal Chinese
women. Hong Kong Med J. 2015; 21:536-541. (in
Chinese)
10.Mendoza N, Sanchez-Borrego R, Villero J, et al. 2013 Up-
date of the consensus statement of the Spanish Menopause
Society on postmenopausal osteoporosis. Maturitas. 2013;
76:99-107.
11.Forstein DA, Bernardini C, Cole RE, Harris ST, Singer
A. Before the breaking point: reducing the risk of
P7
osteoporotic fracture. J Am Osteopath Assoc. 2013;
113:S5-24; quiz S25.
12.Brynin R. Soy and its isoflavones: A review of their
effects on bone density. Altern Med Rev. 2002; 7:317-327.
13.Fan JZ, Yang L, Meng GL, Lin YS, Wei BY, Fan J, Hu
HM, Liu YW, Chen S, Zhang JK, He QZ, Luo ZJ, Liu J.
Estrogen improves the proliferation and differentiation
of hBMSCs derived from postmenopausal osteoporosis
through notch signaling pathway. Mol Cell Biochem.
2014; 392:85-93.
14.Gambacciani M, Levancini M. Management of
postmenopausal osteoporosis and the prevention of
fractures. Panminerva Med. 2014; 56:115-131.
15.Miyamoto T. Mechanism Underlying Post-menopausal
Osteoporosis: HIF1alpha is Required for Osteoclast
Activation by Estrogen Deficiency. Keio J Med. 2015;
64:44-47.
16.Fontenot HB, Harris AL. Pharmacologic management
of osteoporosis. J Obstet Gynecol Neonatal Nurs. 2014;
43:236-245.
17.Maichuk E, Voevodina IV, Mitrokhina TV, Makarova IA,
Iureneva SV. The risk of atherosclerosis and osteoporosis
development in post-ovariectomy syndrome women
during hormone replacement therapy. Ter Arkh. 2014;
86:75-79. (in Russian)
18.Tella SH, Gallagher JC. Prevention and treatment of
postmenopausal osteoporosis. J Steroid Biochem Mol
Biol. 2014; 142:155-170.
19.Wuttke W, Jarry H, Haunschild J, Stecher G, Schuh M,
Seidlova-Wuttke D. The non-estrogenic alternative for
the treatment of climacteric complaints: Black cohosh
(Cimicifuga or Actaea racemosa). J Steroid Biochem Mol
Biol. 2014; 139:302-310.
20.Ge JR, Xie LH, Chen J, Li SQ, Xu HJ, Lai YL, Qiu
LL, Ni CB. Liuwei Dihuang Pill treats postmenopausal
osteoporosis with Shen (Kidney) yin deficiency
via
Janus
kinase/signal transducer and activator of transcription
signal pathway by up-regulating cardiotrophin-like
cytokine factor 1 expression. Chin J Integr Med. 2016;
doi: 10.1007/s11655-016-2744-2.
21.Shuai B, Shen L, Zhu R, Zhou P. Effect of Qing'e
formula on the
in vitro
differentiation of bone marrow-
derived mesenchymal stem cells from proximal femurs
of postmenopausal osteoporotic mice. BMC Complement
Altern Med. 2015; 15:250.
22.Parhat R, Makabel B, Nurhabek U, Tohonrbek A, Hayni,
Song FF, Baysanbek A, Yang HY, Ding G, Zou ZM.
Overview of application and research of Echinops genus
in Chinese medicine. China Journal of Chinese Materia
Medica. 2014; 39:3865. (in Chinese)
23.Liu Y, Ya-Bo JU, Chang H, Tcm DO, Hospital A.
Laboratory study of the effects of mongolian echinops
on bgp and ct of postmenopausal osteoporosis in
experimental rat. Journal of Inner Mongolia Medical
University. 2014; 36(S1): 7-11. (in Chinese)
24.Gao X, Guan L. Effect of Mongolian Blue Thorn on
Serum Alkaline Phosphatase and Interleukin-1 of
Ovariectomized Rats. Chinese Archives of Traditional
Chinese Medicine. 2016; 34(12):2924-2926. (in Chinese)
25.Gao XM, Chang H, Ding CH. Effect of Mongolian
Blue Thorn on Bone Mineral Density and the Maximum
Deflection of Bone in Ovariectomized Rats. Guiding
Journal of Traditional Chinese Medicine & Pharmacy.
2016; 22(24):16-19. (in Chinese)
26.Shahrezaee M, Oryan A, Bastami F, Hosseinpour S,
Shahrezaee MH, Kamali A. Comparative impact of
systemic delivery of atorvastatin, simvastatin, and
lovastatin on bone mineral density of the ovariectomized
rats. Endocrine. 2018; 60:138-150.
27.Peng J, Lai ZG, Fang ZL, Xing S, Hui K, Hao C,
Jin Q, Qi Z, Shen WJ, Dong QN, Bing ZH, Fu
DL. Dimethyloxalylglycine prevents bone loss in
ovariectomized C57BL/6J mice through enhanced
angiogenesis and osteogenesis. PLoS One. 2014;
9:e112744.
28.Compston JE. Sex steroids and bone. Physiol Rev. 2001;
81:419-447.
29.Li L, Chen X, Lv S, Dong M, Zhang L, Tu J, Yang J,
Zhang L, Song Y, Xu L, Zou J. Influence of exercise
on bone remodeling-related hormones and cytokines
in ovariectomized rats: A model of postmenopausal
osteoporosis. PLoS One. 2014; 9:e112845.
30.Parker SE, Troisi R, Wise LA, Palmer JR, Titus-Ernstoff L,
Strohsnitter WC, Hatch EE. Menarche, menopause, years
of menstruation, and the incidence of osteoporosis: the
influence of prenatal exposure to diethylstilbestrol. J Clin
Endocrinol Metab. 2014; 99:594-601.
31.Imai Y. Regulation of bone metabolisms by estrogen/
estrogen receptors signaling. Clin Calcium. 2013;
23:1621-1626. (in Japanese)
32.Xu B, Lovre D, Mauvais-Jarvis F. Effect of selective
estrogen receptor modulators on metabolic homeostasis.
Biochimie. 2016; 124:92-97.
33.Denger S, Reid G, Gannon F. Expression of the estrogen
receptor during differentiation of human osteoclasts.
Steroids. 2008; 73:765-774.
34.Sjogren K, Lagerquist M, Moverare-Skrtic S, Andersson N,
Windahl SH, Swanson C, Mohan S, Poutanen M, Ohlsson
C. Elevated aromatase expression in osteoblasts leads to
increased bone mass without systemic adverse effects. J
Bone Miner Res. 2009; 24:1263-1270.
35.Park K, Ju WC, Yeo JH, Kim JY, Seo HS, Uchida Y,
Cho Y. Increased OPG/RANKL ratio in the conditioned
medium of soybean-treated osteoblasts suppresses
RANKL-induced osteoclast differentiation. Int J Mol
Med. 2014; 33:178-184.
36.Su X, Liao EY, Peng J, Wu XP. The effects of 17
β-estradiol on the expression of osteoprotegerin, the ligand
of osteoprotegerin and related cytokines in osteosarcoma
MG63 cells. Zhonghua Nei Ke Za Zhi. 2003; 42:800-803.
(in Chinese)
37.Ikeda T, Utsuyama M, Hirokawa K. Expression profiles of
receptor activator of nuclear factor kappaB ligand, receptor
activator of nuclear factor kappaB, and osteoprotegerin
messenger RNA in aged and ovariectomized rat bones. J
Bone Miner Res. 2001; 16:1416-1425.
38.Wang Y, Wang WL, Xie WL, Li LZ, Sun J, Sun WJ, Gong
HY. Puerarin stimulates proliferation and differentiation
and protects against cell death in human osteoblastic MG-
63 cells
via
ER-dependent MEK/ERK and PI3K/Akt
activation. Phytomedicine. 2013; 20:787-796.
39.Jin X, Sun J, Yu B, Wang Y, Sun WJ, Yang J, Huang SH,
Xie WL. Daidzein stimulates osteogenesis facilitating
proliferation, differentiation, and antiapoptosis in human
osteoblast-like MG-63 cells
via
estrogen receptor-
dependent MEK/ERK and PI3K/Akt activation. Nutr Res.
2017; 42:20-30.
(Received March 22, 2018; Revised May 4, 2018;
Accepted May 14, 2018)
BioScience Trends
Advance Publication
www.biosciencetrends.com